Table 1

Description of primers and probes used for Real-time RT-PCR. Accession number (Entrez Nucleotide Database), sequences of primers and probes for human iNOS, eNOS, and bNOS; optimal primer and probe concentrations; number of PCR-cycles.

Target

Accession #

Type

Sequence

Concentration (nM)

N cycles


iNOS

XM_034166

FWD

TGGATGCAACCCCATTGTC

300

60

REV

CCCGCTGCCCCAGTTT

50

Probe

6FAM-TCCCCACGGCATGTGAGGATCA-TAMRA

200


eNOS

AF400594

FWD

CGGCATCACCAGGAAGAAGA

300

50

REV

CATGAGCGAGGCGGAGAT

300

Probe

6FAM-TTCACGGCGTTGGCCACTTCTTTAAA-TAMRA

200


bNOS

NM_000620

FWD

GGATCACATGTTCGGTGTTCAG

300

50

REV

CCCAACTTTGCGCTTGAAGA

900

Probe

6FAM-AAATCCAGCCCAATGTCATTTCTGTTCG-TAMRA

200


Törnblom et al. Reproductive Biology and Endocrinology 2005 3:33   doi:10.1186/1477-7827-3-33

Open Data